-------------------------
Running DotKnot

- Switch to the DotKnot working directory:
DotKnot_1.2/scr

- DotKnot takes two arguments, the input FASTA file and a name for the OUTPUT file which contains the detected pseudoknots. 
  The name for the output file is optional. If no output file is specified, the result will be stored by default in "pseudoknots.txt".

For example:
python dotknot.py ../testdata/TMV.fasta ../testdata/TMV_out.txt
OR
python dotknot.py ../testdata/TMV.fasta 

Note that the FASTA file may contain multiple sequences. 

- You can also let DotKnot print a number of near-optimal pseudoknots with best local energy in terms of two criteria. 
  The default number of local near-optimal pseudoknots is 5 for each criterion.
  For an explanation, see http://dotknot.csse.uwa.edu.au/near-optimal-pseudoknots.html
  If you want DotKnot to display the best local pseudoknots, include the option -l:
  
For example:
python dotknot.py ../testdata/TMV.fasta ../testdata/TMV_out.txt -l
OR
python dotknot.py ../testdata/TMV.fasta -l

If you want to predict kissing hairpins, , include the option -k.
If you want to see the global structure, , include the option -g.

-------------------------
Reading the output

- Depending on your choice of OUTPUT file, open the specified OUTPUT file or the default OUTPUT file "pseudoknots.txt".
If pseudoknots were detected, they are listed in a consecutive fashion. Each pseudoknot occupied three lines. 
The first line of each entry has the start and end position of the pseudoknot and the estimated free energy. 
The two following lines contain the sequence and dot-bracket notation. For example (TMV.fasta):

Detected pseudoknots:
35 56 -10.97
ACGGAUUGUGUCCGUAAUCACA
(((((.[[[[)))))...]]]]
57 78 -12.92
CGUGGUGCGUACGAUAACGCAU
(((.[[[[[[)))...]]]]]]
79 108 -8.16
AGUGUUUUUCCCUCCACUUAAAUCGAAGGG
((((.....[[[[.))))........]]]]
111 176 -26.94
GUGUCUUGGAUCGCGCGGGUCAAAUGUAUAUGGUUCAUAUACAUCCGCAGGCACGUAAUAAAGCGA
((((((....[[[[((((((.....(((((((...)))))))))))))))))))........]]]]
192 210 -13.83
CCGUUACCCCCGGUAGGGG
(((...[[[[)))..]]]]

If no pseudoknots were detected, the file reads:
"No pseudoknots were detected."

If you included the option -l for best local pseudoknots, the best local pseudoknots will be displayed on the screen.
If you included the option -g for the global structure, it will be displayed on the screen.
