Near-Optimal Pseudoknots

In addition to the best global folding, the best local H-type pseudoknots and kissing hairpins in terms of two criteria are displayed. This can help to identify promising pseudoknot foldings and may compensate for the limitations of the energy parameters.

DotKnot returns the best pseudoknots in terms of estimated free energy to length ratio. This helps to identify local pseudoknots and will favour pseudoknots with compact structure and low free energy. Additionally, DotKnot returns pseudoknots with lowest estimated free energy. This helps to identify local pseudoknots and will return pseudoknots with lowest free energy, regardless of their lengths. For each criterion, at most five pseudoknots are returned.

Example 1

PseudoBase entry PKB304
PreQ1 riboswitch
1 ... 34
AGAGGUUCUAGCUACACCCUCUAUAAAAAACUAA
(((((...[[[......)))))........]]].

DotKnot does not detect pseudoknots in the global structure. Looking at the near-optimal pseudoknot with best length-normalized free energy, the desired pseudoknot structure is found:

Position: 1 ... 33
AGAGGUUCUAGCUACACCCUCUAUAAAAAACUA
(((((...[[[......)))))........]]]
Estimated free energy: -6.97 kcal/mol

Example 2

PseudoBase entry PKB138
BSMVbeta viral tRNA-like structure
1 ... 96
AUUGGUAUGUAAGCUACAACUUCCGGUAGCUGCGUCACACUUUAAGAGUGUGCAUACUGAGCCGAAGCUCAGCUUCGGUCCCCCAAGGGAAGACCA
.((((((((..((((((..[[[[[.))))))....((((((.....)))))))))))))).((((((.....)))))).........]]]]]....

DotKnot predicts the following two pseudoknots in the global structure:

Position: 4 ... 31
GGUAUGUAAGCUACAACUUCCGGUAGCU
(((.....[[[[[[.)))....]]]]]]
Estimated free energy: -10.35 kcal/mol

Position: 73 ... 95
CUUCGGUCCCCCAAGGGAAGACC
(((.[[[[......)))..]]]]
Estimated free energy: -8.75 kcal/mol

Looking at the near-optimal pseudoknots with lowest free energy, the following pseudoknot is detected with close resemblance to the true structure:

Position: 7 ... 92
AUGUAAGCUACAACUUCCGGUAGCUGCGUCACACUUUAAGAGUGUGCAUACUGAGCCGAAGCUCAGCUUCGGUCCCCCAAGGGAAG
(((..((((((..[[[[[.)))))).)))(((((((...)))))))........((((((((...))))))))........]]]]]
Estimated free energy: -29.3 kcal/mol

Return to the DotKnot start page for submitting a sequence